methylbutane thermo scientific 019387 triton x 100 sigma x100 prolong gold antifade mountant (Thermo Fisher)

Thermo Fisher is a verified supplier

Thermo Fisher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Thermo Fisher methylbutane thermo scientific 019387 triton x 100 sigma x100 prolong gold antifade mountant
Methylbutane Thermo Scientific 019387 Triton X 100 Sigma X100 Prolong Gold Antifade Mountant, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/prolong+gold+antifade/Triton+X-100/pm42349424-137-31-32
Average 99 stars, based on 1 article reviews

methylbutane thermo scientific 019387 triton x 100 sigma x100 prolong gold antifade mountant - by Bioz Stars, 2026-09

99/100 stars

Images

Microscopy:

Article Title: A comparison of human skeletal muscle cell maturation in 2D versus 3D culture: A quantitative proteomic study.
Article Snippet: Cryosections were rehydrated using PBS, then stained with Alexa FluorTM 388 conjugated phalloidin (1:40 dilution; A12379; Thermo Fisher Scientific, Waltham, MA, USA) and DAPI (1:1000 dilution) for 1 h at room temperature. .. Sections were rinsed in wash buffer, then mounted with ProLong Gold Antifade (Thermo Fisher Scientific, Waltham, MA, USA) and images were captured on a Zeiss LSM 800 confocal microscope at 20× magnification. .. Quantification of cryosection images was performed by applying thresholding of the phalloidin staining, then measuring cross- sectional area following dilation and erosion cycles using ImageJ software.

Staining:

Article Title: Comparison of spatial transcriptomics technologies using tumor cryosections.
Article Snippet: .. Sections were then stained with DAPI for 30 s and mounted in Prolong Gold Antifade (Thermo Fisher Scientific). ..

Bicinchoninic Acid Protein Assay:

Article Title: Combination of in vivo and in vitro phosphoproteomics determines the PP2A target repertoire on proteome scale.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti RPS6-pS235/236 ProteinTech Cat#29223-1-AP; RRID:AB_2918253 Mouse monoclonal anti RPS6 Santa Cruz Biotech Cat#sc-74459; RRID:AB_1129205 Mouse monoclonal anti β-Actin Santa Cruz Biotech Cat#sc-47778HRP; RRID:AB_2714189 Mouse monoclonal anti PP2A-B55-a Santa Cruz Biotech Cat# sc-81606; RRID:AB_2252935 Rabbit polyclonal anti PP2A C subunit Cell Signaling Cat# 2038; RRID:AB_2169495 Mouse monoclonal anti PPP2R1A/B Santa Cruz Biotech Cat# sc-13600; RRID:AB_628178 Mouse monoclonal anti PPP2R5E Santa Cruz Biotech Cat# sc-376176; RRID:AB_10986266 Mouse monoclonal anti MYPT1 Santa Cruz Biotech Cat# sc-514261 Rabbit polyclonal anti EIF4B Cell Signaling Cat# 3592; RRID:AB_2293388 Rabbit polyclonal anti EIF4B pS422 Cell Signaling Cat# 3591; RRID:AB_2097522 Mouse monoclonal anti PPP1CA Santa Cruz Biotech Cat# sc-7482; RRID:AB_628177 Rabbit polyclonal anti Caprin1 ProteinTech Cat#15112-1-AP RRID:AB_2070016 Mouse monoclonal anti G3BP1 Santa Cruz Biotech Cat#sc-365338 RRID:AB_10846950 Donkey anti-mouse IgG (H + L) Secondary, Alexa Fluor 488 Conjugated Thermo Scientific Cat#A21202 RRID:AB_141607 Goat anti-rabbit IgG (H + L), Alexa Fluor 633 Conjugated Thermo Scientific Cat#A21071 RRID:AB_141419 Peroxidase-conjugated goat anti-rabbit IgG Jackson Immuno Research Cat#111-035-045; RRID:AB_2337938 Peroxidase-conjugated goat anti-mouse IgG Jackson Immuno Research Cat#115-035-062; RRID:AB_2338504 Bacterial and virus strains E. coli DH5a CGSC Cat#12384 Chemicals, peptides, and recombinant proteins Dulbecco’s Modified Eagle Medium (DMEM) PAN Biotech Cat#P04-04510 Fetal Bovine Serum (FBS) BioWest Cat#S181B-500 Trypsin for cell culture PAN Biotech Cat#P10-023100 Penicillin-Streptomycin PAN Biotech Cat#P06-07100 PP2A inhibitor LB100 RayBiotech Cat#332-11915-2 PP2A inhibitor okadaic Acid Merck Cat#O9381 Hank’s Balanced Salt Solution (HBSS) Gibco Cat#14025-100 Dulbecco’s Phosphate Buffered Saline (DPBS) PAN Biotech Cat#P04-36500 Strep-Tactin XT-4Flow Slurry IBA Cat#2-5030-010 Microcystin LR Enzo Life Sciences Cat#ALX-350-012-M001 Doxycycline Sigma-Aldrich Cat#D9891 Nitrocellulose membrane 0.45 mm Amersham Cat#GE10600000 Benzonase Sigma-Aldrich Cat#1.01697.0001 PhosSTOP Roche Cat#04-906-837-001 Proteases Inhibitor Cocktail Roche Cat#11-697-498-001 (Continued on next page) e1 Cell Reports Methods 5, 101084, July 21, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER NHS-activated Sepharose 4 fast flow GE Healthcare Cat#17-0906-01 Trifluoroacetic acid (TFA) Sigma-Aldrich Cat#302031 Formic acid (FA) Merck Cat#5.43804.0250 Ammonia solution 25% Merck Cat#5438300250 Trypsin Promega Cat#V5113 ATP Sigma-Aldrich Cat#A6419 Vivacon 500, 100 ′ 000 MWCO Sartorius Cat#VN01H42 Lys-C FUJIFILM Wako Pure Chemical Corporation Cat#129-02541 HR-X Column Macherey-Nagel Cat#730936P45 MS-grade Water VWR Cat#23595.328 MS-grade Acetonitrile VWR Cat#20060.32 Biotin Sigma-Aldrich Cat#B4501 Collagen I ThermoFisher Cat#A10483-01 Hoechst 3342 Sigma-Aldrich Cat14533 ProLong Gold antifade ThermoFisher Cat#P36931 Horse serum ThermoFisher Cat#16050 Critical commercial assays Pierce BCA Protein Assay Kit Cat#PIER23225 WesternBright ECL Advansta Cat#K-12045-D50 SuperSignal West Femto Chemiluminescent Substrate Pierce Cat#PIER34096 Deposited data MS raw data ProteomeXchange PXD050485; PXD060829 Western blot uncropped images Mendeley Data https://doi.org/10.17632/h9w2yv39xp.1 PRM data PanoramaWeb https://panoramaweb.org/4DfEpv.url Experimental models: Cell lines A549 cells ATCC Cat#CCL-185 HeLa cells ATCC Cat#CCL-2 SHA-PPP1CA HeLa (Figures 2 and S2) This study N/A SHA-PPP2CA HeLa (Figures 2, 3, and S2) This study N/A SHA-PPP2R5E HeLa (Figures 4 and S3) This study N/A Oligonucleotides oNDS286 This study 5 ′ cgatgaaaatttatattttcaag gtatggacgagaaggtgttcacc 3 ′ oNDS287 This study 5 ′ catatccagtcactatggt cgacctgcagttacaggaagta gtctggggtacg 3 ′ oNDS292 This study 5 ′ cgatgaaaatttatatttt caaggtatgtccgacag cgagaagc 3 ′ oNDS293 This study 5 ′ catatccagtcactatggtcga cctgcagttatttcttggctttgg cggaattgc 3 ′ Recombinant DNA psPAX2 Addgene Plasmid #12260 pMD2.G Addgene Plasmid #12259 pBabe Zeo PPP2CA WT Addgene Plasmid #10689 pSKP-173 (StrepHA-PPP2CA) Generated in this study N/A (Continued on next page) Cell Reports Methods 5, 101084, July 21, 2025 e2 OPEN ACCESS .. A549 and HeLa cells (CCl-185 and CCL-2 respectively, authenticated by genotyping (Microsynth) and tested negative for mycoplasma) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, PAN Biotech, P04-04510) supplemented with 10% fetal bovine serum (FBS, BioWest, S181B-500) and 100 units/ml penicillin and 0.1 mg/mL streptomycin (PAN Biotech, P06-07100) at 37 ◦ C and 5% CO 2 .

Western Blot:

Targeted Proteomics:

Recombinant:

Plasmid Preparation:

Generated:

Incubation:

Article Title: Mrc1 (MMR, CD206) controls the blood proteome in reducing inflammation, age-associated organ dysfunction and mortality in sepsis.
Article Snippet: After washing 5 times with PBS, donkey anti-goat 594 (Invitrogen, #A11058) and donkey antirabbit 488 (Invitrogen, #A21206) secondary antibodies were added (1:100) and incubated at RT in the dark for 45mins. .. Slides were then incubated with DAPI (Invitrogen, #D1306, 1:4000), washed, then air dried following addition of Prolong gold antifade (ThermoFisher Scientific, #P36930). .. Microscopic work was performed using the Zeiss AxioImager Z1 microscope system equipped with TissueGnostics microscopy workstation, Hamamatsu C13440-20C camera, PixeLINK PL-D673CU camera, and Lumen Dynamics X-Cite XLED1 illuminator.

Review